IKP

LexA | LexA repressor (protein, positive control)

Product no: AS21 4541P
AS21 4541PProtein/positive control for Western blot
459
Add to cart
Delivery:  3-6 business days
  • Product Info
  • Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
    Format: Liquid
    Quantity: 20 g
    Storage: Store at -20C or -80C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
    Tested applications: Western blot (WB)
    Expected | apparent MW: 22,3 | 23 kDa
  • Application Examples
  • Purified LexA protein (positive control for Western blot)
    5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie.
  • Additional Information
  • Additional information: This product can be used in:
    • Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
    • Western blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA gene
    • control in ChIP in combination with anti-LexA antibodies
    Additional information (application): LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
  • Background
  • Background: Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
  • Product Citations
  • Selected references: 38221900
  • Protocols
  • Agrisera Western Blot protocol and video tutorials
  • Reviews:
  • Reviews
    Below, you can grade the product on a scale from 0 to 5.
    Please also provide information about species, application, dilution and obtained result for the reviewed antibody.
    Your name will be displayed as the sender.
    Number of reviews: (0)

    This product doesn't have any reviews.

Accessories

AS09 602 |  Clonality: Polyclonal | Host: Goat | Reactivity: Rabbit IgG (H&L)

213 €
Add to cart
Info
img missing
AS21 4542 | Clonality: Polyclonal  |  Host: Rabbit |  Reactivity: Escherichia coli
344 €
Add to cart
Info
img missing
AS21 4541 | Clonality: Polyclonal  |  Host: Rabbit |  Reactivity: Escherichia coli
361 €
Add to cart
Info
Close