LexA | LexA repressor (protein, positive control)
AS21 4541P | Protein/positive control for Western blot

Data sheet | Product citations | Protocols | Add review |
Product Information
Purity
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Format
Liquid
Quantity
20 ĩg
Storage
Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Tested applications
Western blot (WB)
Expected | apparent MW
22,3 | 23 kDa
Reactivity
Application examples
Application examples

5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie.

5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie.
Additional information
Additional information
This product can be used in:
- Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
- Western blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA gene
- control in ChIP in combination with anti-LexA antibodies
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Background
Background
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product citations
Related products: LexA | LexA repressor (protein, positive control)
AS16 ECL-S-N | low pico to mid femtogram and extreme low femtogram detection
This product can b...
This product can b...
From 26 €
AS09 602 | Clonality: Polyclonal | Host: Goat | Reactivity: Rabbit IgG (H&L)
10 ...
10 ...
201 €
AS21 4541 | Clonality: Polyclonal | Host: Rabbit | Reactivity: Escherichia coli
342 €
AS21 4542 | Clonality: Polyclonal | Host: Rabbit | Reactivity: Escherichia coli
326 €