Name:
Phone:
E-mail:
Address:






LexA | LexA repressor (protein, positive control)

AS21 4541PProtein/positive control for Western blot
LexA | LexA repressor (protein, positive control) in the group Antibodies Other Species / Bacteria at Agrisera AB (Antibodies for research) (AS21 4541P)



DATA SHEET IN PDF

Qty: 
435
How to cite this product:
Product name, number (Agrisera, Sweden)

Data sheet Product citations Protocols Add review

Product Information

Purity Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Format Liquid
Quantity 20 ĩg
Storage Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Tested applications Western blot (WB)
Expected | apparent MW 22,3 | 23 kDa

Reactivity

Application examples

Application examples Purified LexA protein (positive control for Western blot)
5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie.

Additional information

Additional information This product can be used in:
  • Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
  • Western blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA gene
  • control in ChIP in combination with anti-LexA antibodies
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2

Related products

Background

Background Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S

Product citations

Purity: Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Format: Liquid
Quantity: 20 ĩg
storage: Store at -20°C or -80°C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
tested applications: Western blot (WB)
calculated | apparent molecular mass [kDa]: 22,3 | 23 kDa
Picture (footer): Purified LexA protein (positive control for Western blot)
5 and 2 µg of highly purified LexA protein from Escherichia coli was separated on SDS-PAGE and stained by Coomasie.
additional information: This product can be used in:
  • Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulation
  • Western blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA gene
  • control in ChIP in combination with anti-LexA antibodies
additional information (application): LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
background: Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S

Related products: LexA | LexA repressor (protein, positive control)

AS16 ECL-S-N | low pico to mid femtogram and extreme low femtogram detection

This product can b...
From 26 €
AS09 602 |  Clonality: Polyclonal | Host: Goat | Reactivity: Rabbit IgG (H&L)

10 ...
201 €
AS21 4541 | Clonality: Polyclonal  |  Host: Rabbit |  Reactivity: Escherichia coli
342 €
AS21 4542 | Clonality: Polyclonal  |  Host: Rabbit |  Reactivity: Escherichia coli
326 €